Zinan Xie, Peng Song, Ying Zhong, Jing Guo, Lang Gui,＊, Mingyou Li,＊

aInternational Research Center for Marine Biosciences, Ministry of Science and Technology, Shanghai Ocean University, Shanghai, 201306, China

bKey Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai, 201306, China

ABSTRACT

Germ cells of many organisms exhibit a unique perinuclear cytoplasmic cloud-like structure called the chromatoid body (CB). Specific components of the CB, such as vasa, are crucial for germline development. Herein we identify another component of the CB, the Oryzias latipes gcnf homolog (Olgcnf). By reverse transcription polymerase chain reaction (RT-PCR), Olgcnf transcript was restricted to gonads in the adult tissues and was maternally provided and persisted throughout embryogenesis. By in situ hybridization on gonadal sections, Olgcnf transcript was restricted to germ cells. In the ovary, Olgcnf was predominantly expressed in the early stages of oocytes. In the testis, Olgcnf showed dynamic expression in round spermatids and sperm, accumulated in the CB during spermatid morphogenesis and concentrated in elongated spermatids of acrosome cap region and flagellar manchette. Moreover, Olgcnf was colocalized with vasa, which is the best-characterized component of the CB.Therefore, Olgcnf is specific to germ cells of both sexes and is a component of the CB during spermiogenesis.

ARTICLEINFO

Keywords:

Gcnf

Medaka

Ovary

Testis

1.Introduction

At present, the freshwater fishery industry is developing rapidly in China, accounting for nearly one-third of the fishing market worldwide(Zhang et al., 2019). However, it also has encountered great challenges,including the degradation of germplasm resources and the extension of sexual maturity, which have caused large economic losses (Gui et al.,2018). Studying the factors related to biologic functions of germ cell-genes is the focus of current research and the basis for further research to solve the current problem.

In most animals, germ cells are responsible for transmitting genetic information from one generation to another. Germ cells undergo gametogenesis in order to generate eggs in the female and sperm in the male (Raz & Erez, 2003). Oogenesis experiences the oogonial proliferation at mitotic stage and the oocyte maturation at meiotic stage.Spermatogenesis is a highly regulated process, including mitotic,meiotic and postmeiotic phases (Hong, Liu et al., 2004). In the mammalian testis, a seminiferous tubule has various stages of male germ cells, including mitotic spermatogonia, meiotic spermatocytes, postmeiotic spermatids, and mature sperm (Brinster, 2007). During postmeiotic phase, the round spermatids will elongate and differentiate into mature sperm by a process called spermiogenesis. A remarkable event will occur such as nuclear reorganization and marked changes in the volume and structure of cytoplasm and organelles during spermiogenesis. The mature sperm contains highly condensed haploid nucleus,ahead with the acrosomal cap and a long flagellum (Brinster, 2007).

Many RNA-binding proteins, preferentially or exclusively expressed in germ cells, are encoded by germ genes (Hong, Li et al., 2016; Li, Shen et al., 2011; Li, Song et al., 2019; Zhu et al., 2018), among which one of the best -studied germ genes is vasa, its sequence is highly conserved in animal kingdom and its RNA or protein can identify germ cells in embryos and adult tissues (Fujiwara, Komiya et al., 1994; Lasko & Ashburner, 1988; Tanaka et al., 2001). In Drosophila, vasa is required for primordial germ cells (PGCs) formation (Johnstone & Lasko, 2001). In mouse, targeted vasa gene disruption affects survival of PGCs after their migration into gonads and results in male infertility (Tanaka, Toyooka et al., 2000). In medaka, knockdown of vasa gene expression by morpholino injection leads to ectopic PGCs (Li et al., 2009).

Many germ genes’ RNA and/or protein are often the components of“germ plasm”, a unique perinuclear cytoplasmic cloud-like structure of germ cells of diverse animals including zebrafish PGCs (Knaut et al.,2000). Germ plasm exhibits varying structures (Voronina et al., 2011).In male, germ plasm occurs as a mitochondrial cloud in spermatogonia,and then becomes “intermitochondrial cement” in spermatocytes(Yokota, 2008). At last, it develops into the chromatoid body (CB) in the postmeiotic stage (Shang, Baarends et al., 2010). The CB is required for mRNA storage and processing as a germ-cell-specific center, and in mammalian, it has been reported to be localized in spermatids nucleus surface, or around the sperm neck between the head and midpiece(Ginter-Matuszewska, Kusz et al., 2011). In mouse, the CB is identified by the expression of vasa (Kotaja, Bhattacharyya et al., 2006). In addition, GCNF bound by vasa and Hub is also accumulates in CB of early spermatids, where the RNA binding protein resides (Preiss, Nguyen Chi et al., 2009).

Germ cell nuclear factor (gcnf)—a germ cell marker gene and nervous related gene—was first identified in mouse as an orphan member of the nuclear receptor superfamily and a ligand-activated transcription factor(Chen et al., 1994), and it is highly conserved and plays essential roles in gonadal development (Zechel, 2005) and embryonic development(Wang & Cooney, 2013). Gcnf RNA or peptides have been reported in the ovary and testis of several species, including zebrafish (Braat, Zandbergen et al., 1999), Xenopus (Schohl et al., 2002), mouse and human(Agoulnik et al., 1998). Furthermore, gcnf also exhibits some significant functions in Xenopus (Barreto et al., 2003; David et al., 1998), mouse(Hummelke & Cooney, 2004; Lan et al., 2002; Park, Do et al., 2018;Susens et al., 1997; Wang et al., 2014) and human (Rajkovic, Middendorff et al., 2004; Wang et al., 2016). Although there are many related studies on gcnf, its biologic functions in other teleosts remain unclear. Its expression and functions, therefore, need to be systematically analyzed for other fish.

Medaka is a good model to study germ cells and reproductive biology(Lin et al., 2016). Recently we have shown that Vasa protein identifies dynamic germ plasm reorganization and is a component of the CB in medaka (Yuan et al., 2014). Herein we identified another component of the CB, the medaka gcnf gene (Olgcnf), and analyzed its sequence and expression patterns. By compared with vasa expression throughout gonadal development, Olgcnf exhibited remarkably dynamic cytoplasmic localization and distribution between the CB and nucleus during spermatid differentiation. Our results indicated that Olgcnf exhibited dynamic accumulation in the CB during spermatid differentiation. The finding could have profound implications for fish reproductive development.

2.Materials and methods

2.1.Fish and embryos

The present experiment with medaka fish was approved by the Ethics Committee of Shanghai Ocean University. Adult wild-type medaka were maintained at a suitable density in a recirculating culture system with water temperature (26 ± 2)C, fed daily with artemia and kept at controlled light to dark cycle at 14 L: 10 D. Embryonic developmental stages were described previously (Iwamatsu, 2004; Li et al., 2016).

2.2.Gene cloning

The Olgcnf sequence was cloned by RACEs (5- and 3-rapid amplification of cDNA ends) approach. Total RNA from different developmental stages embryos (2 cells, blastula, gastrula, neurula, 3 days, 7 days and fry) and seven adult organs (eye, brain, kidney, liver, gut, ovary and testis) was extracted by TRizol® (Invitrogen, Carlsbad, CA). The firststrand cDNA from 1 μg of total RNA was synthesized by using Super SMART™ PCR Synthesis Kit (Clontech, USA) according to the manufacturer’s instructions. Using zebrafish Gcnf proteins sequences as queries, we blasted the public EST sequences from medaka and obtained cloning called BJ010828 that contains the partial sequence of Olgcnf.Based on this fragment, the gene-specific primer 5RACE (AGGGTGGGACTGTGGGTAAAGGCTGCG) & 3RACE (ATAATGATGTGTCTGCCGGAGATC) were designed. Finally, Olgcnf full length cDNA was obtained by combining 5RACE sequence, 3RACE sequence and BJ010828 sequence, and it was confirmed by RT-PCR with two terminal primers(Fig. S1A). The phylogenetic tree was constructed by using MEGA(version 5.0) with neighbor-joining (NJ) (Tamura et al., 2013) and protein alignment was performed using Vector NTI (version 11.5).

Fig. 1.Olgcnf is the ortholog of the human GCNF gene. (A) Phylogenetic tree of OlGcnf. Bootstrap values are given. Accession numbers follow organism. (B) OlGcnf domain structures and percentage of sequence identity between medaka and other organisms.(C) Conserved genomic organization of the Olgcnf gene in medaka (MK645237),zebrafish (NM131256.2), mouse(NM001159548.1), and human(NM001278546.1). Translated exons and untranslated exons are shown. (D)Chromosomal synteny. Chr, chromosome. Numerals in parenthesis denote chromosomal positions (http://www.en sembl.org). The medaka nr6a1 (Olgcnf)is on chromosome 9, which shows a syntenic relationship to the gcnf-bearing region on human chromosome 9, mouse chromosome 2 and zebrafish chromosome 8.

Fig. 2.Expression of Olgcnf transcripts in medaka gonads. (A and B) RT-PCR analysis of Olgcnf in developing embryos (A) and adult tissues (B). (C–J)Germ cells specific expression of Olgcnf RNA in gonads, adult gonadal cryosections were hybridized to antisense riboprobes and visualized by chromogenic ISH staining. (C–E) Overview of Olgcnf RNA expression in the adult ovary (C) and testis (D–E). (F–J)larger magnification view showing different stages during spermiogenesis. Olgcnf was detected in early stages of oocytes and was highly expressed in spermatids and sperm. I–V, stages of oocytes; sg, spermatogonia; sc, spermatocytes; st, spermatids; sm,sperm; rs1, round spermatids 1; rs2, round spermatids 2; es, elongated spermatids; ets, elongated spermatids. Scale bars, 50 μm in (C–D), 25 μm in(E–F) and 5 μm in (G–J).

Fig. 3.Expression of Olgcnf and vasa transcripts in medaka ovary analyzed by FISH. Adult ovarian cryosections were hybridized to antisense RNA probes and the signals were visualized by fluorescence staining. Nuclei were stained by DAPI (blue). (A)Olgcnf probe. (B) vasa probe. (C and D) Merge of Olgcnf and vasa signals. The transcripts of Olgcnf and vasa were highly expressed in early stages of oocytes and weakly expressed in later stages of oocytes. In addition, vasa exhibits detectable expression in oogonia. I–V, stages of oocytes; og, oogonia. Scale bars, 50 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

2.3.RT-PCR

M-MLV reverse transcriptase (Takara, Shiga, Japan) was used to synthesize cDNA from 1 μg total RNA with oligo (dT) primer. Olgcnf primers F & R (ATGGAGATAGACAAGCGGACG and TTAGTTTCCAGAGGAGGCGGT) were used to amplify Olgcnf fragment, and β-actin amplified by using primers F & R (TTCAACAGCCCTGCCATGTA and CCTCCAATCCAGACAGTAT) was used as internal control. A total volume of 25 μL in the PCR reaction system was used, consisting of 17 μL PCR mix, 2 μL cDNA template, 1 μL primer, and 5 μL ddHO. The RT-PCR was carried out for 35 cycles in a 25 μL reaction volume under the following conditions: 96C for 10 s, 59C for 25 s, and 72C for 1 min 20 s. The PCR products were detected in 1% agarose gel stained with ethidium bromide and visualized on a bioimaging system (BIO-RAD,Hercules, CA, USA).

2.4.Chromogenic and fluorescence in situ hybridization

Olgcnf CDS (coding sequence,CDS) was ligated into pGEM-T vector,and then the plasmid was linearized with SP6 or T7 polymerase for sense and antisense RNA probe synthesis (Roche, Basel, Switzerland). Chromogenic in situ hybridization (ISH) and fluorescence in situ hybridization(FISH) were performed as described previously (Li, Shen et al., 2011; Xu et al., 2009). Nitrotetrazolium blue chloride substrate and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) were used for ISH chromogenic staining on sections. According to the product manual,FISH was implemented by using the (TSA™) Plus Fluorescence Systems(Life Technologies, Carlsbad, CA, USA), while 4-6-diamidino-2-phenylindole (DAPI) was used to stain nuclei. A gold anti-fade reagent was used with slide mounting (Invitrogen, Carlsbad, CA, USA).

2.5.Microscopy

Observations and photomicrography were performed as described previously (Sun et al., 2020). Photomicrographs were taken with a Nikon Ds-Ri2 system under a stereomicroscope (Nikon, Japan).

3.Results

3.1.Cloning and characterization of Olgcnf

The Olgcnf cDNA (GenBank: MK645237) was 2282 bp in length,including a 1455 bp CDS encoding 484 amino acids, a 46 bp 5UTR and a 781 bp 3UTR (Fig. S1A). Multiple alignment demonstrated high identity with Gcnf orthologs from other species, ranging from 88% in puffer fish to 79% in human (Fig. S1B). The OlGcnf possessed typical Gcnf homolog domains such as DNA-binding domain (DBD) and ligand-binding domain (LBD).

The phylogenetic tree revealed that Gcnf forms two main evolutionary clades comprising fish clade and tetrapod clade, and its DBD is rather conserved (97%−93%) (Fig. 1A and B). Genetic structure comparison and chromosomal synteny analysis indicated that Olgcnf is highly conserved in evolution from fish to human (Fig. 1C and D).

3.2.Olgcnf RNA expression by RT-PCR analysis

By RT-PCR, the Olgcnf transcript was expressed as early as two cells stage and its expression persisted throughout embryogenesis (Fig. 2A),which suggested that Olgcnf is maternally inherited. In adult tissues,Olgcnf was restricted in adult gonads of both sexes, and there was no detectable signal in any somatic tissues (Fig. 2B).

3.3.Germ cells specific expression of Olgcnf RNA in gonads

To reveal the cellular distribution of Olgcnf, chromogenic ISH was performed on gonadal sections. The Olgcnf signal was limited in germ cells of ovary and testis. In the ovary, strong Olgcnf signal was expressed in stage I−II of oocytes, with a marked reduction in stage III of oocytes,and it was absent in stage IV−V of oocytes (Fig. 2C).

In the testis, Olgcnf was highly abundant in round spermatids and sperm during postmeiotic divisions but was absent in spermatogonia and spermatocytes (Fig. 2D−F). In addition, Olgcnf signal was expressed around the spherical nuclear structure in round spermatids and sperm,remained prominent during spermiogenesis. Interestingly, Olgcnf signal was concentrated in cytoplasmic cap or arc in close contact with the nucleus although it was diffused throughout the cytoplasm (Fig. 2G).The sense probe was undetectable in the gonads (data not shown).

3.4.Olgcnf RNA expression in early stages of oocytes

To better understand the expression of Olgcnf, co-localization of Olgcnf and vasa by FISH was used to distinguish the expression patterns accurately between Olgcnf and vasa, the latter being a useful tool to evaluate fish germ cell development in different organisms, including medaka (Li, Hong et al., 2009; Li et al., 2015; Yuan et al., 2014). In the ovary, vasa was present in germ cells during oogenesis, with the most intense signal in oogonia, and the signal remained in young oocytes but disappeared in mature oocytes (Fig. 3B−D). In contrast, except for the strongest signal in early stages of oocytes, Olgcnf was absent in oogonia(Fig. 3A−D).

3.5.Dynamic accumulation of Olgcnf in CB during spermatid differentiation

In the testis, vasa transcript was abundant in spermatogonia, persists at reduced levels from spermatocytes to sperm (Fig. 4B−D). In contrast,Olgcnf signal remained high in round spermatids and sperm, but was undetectable in spermatogonia and spermatocytes (Fig. 4A−D).Intriguingly, Olgcnf signal was shown to localize with the phase contrast image of CB, thus confirming the localization of Olgcnf in this structure(Fig. 4E).

Fig. 4.Expression of Olgcnf and vasa transcripts in medaka testis analyzed by FISH. Adult testicular cryosections were hybridized to antisense RNA probes, and the signals were visualized by fluorescence staining. Nuclei were stained by DAPI (blue).(A) Olgcnf probe. (B) vasa probe. (C–D) Merge of Olgcnf and vasa signals. (E) Larger Magnification view showing different stages during spermiogenesis. Olgcnf and vasa show distinct stage-preferential expression patterns. The Olgcnf signal exhibits in round spermatids and sperm, whereas the vasa signal peaks in spermatogonia and persists at reduced levels from spermatocytes to spermatids. sg, spermatogonia; sc, spermatocytes; st, spermatids; sm,sperm. Scale bars, 50 μm in (A–D) and 5 μm in (E).(For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

The presence of Olgcnf in the CB urged us to study its expression further during spermiogenesis (Fig. 5). A detailed analysis along the differentiation of male germ cells shows a stage-dependent distribution of Olgcnf in the CB: In round spermatids, the CB is still dispersed in the cytoplasm and Olgcnf signal was concentrated in the head and caudal pole, in which they were located in a cap-like CB. In elongating spermatids, cap-like CB start condensing, and Olgcnf shows dynamic subcellular distribution. In elongated spermatids, CB are gradually condensed to the final form corresponding to the mature CB seen also at later stages, and Olgcnf was localized in the acrosome cap region and in the flagellar manchette of the spermatid elongation.

Fig. 5.Co-localization of Olgcnf with vasa in CB.Adult testicular cryosections were hybridized to antisense RNA probes, and the signals were visualized by dual color fluorescence staining. Nuclei were stained in blue with DAPI. In round spermatids, CB is still dispersed in the cytoplasm and Olgcnf signal colocalize with vasa is concentrated in the CB. In elongating and elongated spermatids, CB start condensing, condensed to the final form corresponding to the mature CB seen also at later stages.Olgcnf signal was localized in the acrosome cap region and the flagellar manchette of the spermatid elongation in the peripheral region of the nucleus.Scale bars, 5 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 6.Schematic illustration summarizing expression pattern of Olgcnf in testis. Olgcnf is absent during spermatogenesis and present during spermiogenesis. In round spermatid, Olgcnf mainly locates in CB of the peripheral region of the nucleus. In elongating and elongated spermatid, the signal is localized in the acrosome cap region and in the flagellar manchette.

4.Discussion

In this study, we cloned Olgcnf—the Oryzias latipes gcnf homolog—and analyzed its RNA expression pattern in adult gonads and developing embryos. Olgcnf expression is maternally supplied and is specific to germ cells of both sexes. The cellular distribution of Olgcnf in adult gonads shows the expression in growing oocytes and spermatids and sperm. Especially in the testis, Olgcnf occurs not only in acrosome cap region and flagellar manchette of postmeiotic germ cells, but also in CB during spermiogenesis. Expression of CB has also been reported for the mouse gcnf (Preiss, Nguyen Chi et al., 2009). Therefore, Olgcnf is a component of CB during spermiogenesis.

In the present study, Olgcnf was highly conserved from fish to human.Firstly, Olgcnf showed highly identical with other species and contained the characteristic domains, including LBD and DBD. The homology of DBD is extremely high, which is the main functional domain as LBD does not mediate any function independent of DBD (Lan et al., 2002). Secondly, OlGcnf was located in the Gcnf subgroups through phylogenetic tree analysis. Finally, genetic structure comparison and chromosomal synteny indicated that Olgcnf was a homolog of other species gcnf.

Then the expression of Olgcnf in embryos and adult tissues were further analyzed. In the developing embryos, Olgcnf signal persisted during embryogenesis. This phenomenon is similar with that of mouse(Chung, Katz et al., 2001; Hummelke & Cooney, 2001; Susens et al.,1997). In adult tissues, Olgcnf signal was restricted in adult gonads of both sexes and there was no detectable signal in the somatic tissue. The high expression of Olgcnf in adult gonads, suggesting that Olgcnf affects the gonadal development, as is the case in mammal (Sabour, Xu et al.,2014). Therefore, it is likely that Olgcnf is maternally accumulated and plays essential roles in both sexes of medaka.

To elucidate the potential roles of Olgcnf in medaka gonads development, the subcellular localization of Olgcnf was performed. In the ovary, Olgcnf was present in early stages of oocytes. It shows that the presence of Olgcnf may be relevant to the initiation of meiosis (Katz et al., 1997), which is similar with a previous study that gcnf affects the previtellogenic oocytes in zebrafish (Chen et al., 1994) and Xenopus(Schohl et al., 2002). Additionally, Olgcnf has some essential regulatory mechanism. In mouse, the expression of GCNF target gene c-mos (Zilz &Cooper, 2004), a proto-oncogene which has been shown to be important for normal progression from meiosis I to meiosis II, as well as the maintenance of metaphase arrest was shown in the ovary (Wianny &Zernicka-Goetz, 2000). A study found gcnf induces the two growth factors, which is the paracrine signaling molecules BMP-15 and GDF-9,affecting female reproduction (Juengel, Bodensteiner et al., 2004).These data illustrate that Olgcnf is involved in the regulation some aspect of meiosis and affects ovarian function. However, more information about Olgcnf in ovary should be needed.

In the testis, Olgcnf was detected in spermatids and sperm, and absent in spermatogonia and spermatocytes. It indicates that Olgcnf is involved in the postmeiotic germ cells. This expression pattern has similarly described for gcnf in mouse testis (Hirose et al., 1995; Sabour, Xu et al.,2014), in which gcnf was detected in postmeiotic germ cells. In mouse,two candidate targets for GCNF, protamine 1 and protamine 2 induce post-meiotically,first being observed in round spermatids (Govin et al.,2004; Hummelke et al., 1998). However, the expression in the postmeiotic germ cells contrasts the expression observed in zebrafish testis,whose gcnf only exists in the spermatocytes (Braat et al., 1999). The expression pattern observed in medaka suggests a function for gcnf in late spermiogenesis, while in the zebrafish, a role in spermatocyte formation has been proposed. The differential spatial expression of gcnf in medaka and zebrafish suggests that gcnf, in these species, has different function in germ cell formation. Meanwhile, the mechanism by which gcnf is activated, in the medaka, as well as in zebrafish, need to be clarified.

In addition, Olgcnf expression in CB of adult male germ cells was analyzed. A striking observation is the localization of Olgcnf to the CB during spermatid differentiation (Fig. 6). Specifically, Olgcnf appears as CB in round spermatids, distributes dynamically in CB of elongating spermatids, culminates in the acrosome cap region and flagellar manchette of elongated spermatids. These features are also supported by studies in mouse (Bizkarguenaga et al., 2019; Nguyen Chi, Chalmel et al., 2009; Xu et al., 2004). Moreover, Olgcnf accumulates in CB of spermatids and sperm, showed dynamic localization with vasa, a component of CB (Kotaja, Bhattacharyya et al., 2006; Kotaja, Lin, Parvinen & Sassone-Corsi, 2006). We conclude that Olgcnf is a component of CB during spermatid differentiation and its expression shows dynamic CB redistribution in medaka. Therefore, CB undergoes reorganization,and thus forms varying fine structures during different stages of male germ cell development in medaka.

CB is a germ-cell-specific cytoplasmic structure. It has been reported in various species (Susi & Clermont, 1970; Yuan et al., 2014). In mouse,CB appears to comprise thin filaments consolidated into a compact mass or into dense strands of varying thickness that branch to form an irregular network (Fawcett et al., 1970). An obvious finding in this paper is that CB is able to form distinct materials. First, the CB is still dispersed in the cytoplasm of round spermatids. These germ cells densely cluster together and still present round shape. Then, CB-like-structures appear in the cytoplasm of elongating spermatids. These cells disperse during spermiogenesis and start to be out of shape. At this point, CB is not fully condensed but appear as a more diffuse material. At last, CB condenses to form a dense granule around the cell nucleus that becomes typical of later stages of elongated spermatids, and these cells finally form a free state. Since these features are reminiscent of those described for CB in mouse (Kotaja & Sassone-Corsi, 2007; Shang, Baarends et al., 2010).Therefore, the mechanisms underlying CB formation are highly conserved in diverse species. Additionally, the CB may provide Olgcnf with a privileged platform throughout spermatid differentiation.

Our studies show that Olgcnf expression identifies meiotic germ cells in both sexes, and in the testis, Olgcnf acts as an integral component of CB that plays essential roles in spermatid differentiation and flagellar formation. The present study defines medaka spermiogenesis from the respect of Olgcnf expression and contributes additional information regarding important regulatory areas for gcnf. These results contribute to a better understanding of the role of gcnf acted as an important factors in the reproductive development, and also take further steps on the basis of related research on the reproduction and development.

CRediT authorship contribution statement

Zinan Xie: Formal analysis, Writing - original draft. Peng Song:Writing - original draft. Ying Zhong: Formal analysis. Jing Guo: Formal analysis. Lang Gui: Formal analysis, Writing - original draft. Mingyou Li: Formal analysis, Writing - original draft.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (31672700) and National Key R&D Program of China(2018YFD0901205).

Appendix A.Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.aaf.2020.06.006.