Yang Sun,Yue Sun,Song-Zhe Li,Min Sun,Ming-Qi Li,Ya-Xian Wang＊

1Heilongjiang University of Chinese Medicine,Harbin,150040,China;2Tumor Hospital of Harbin Medical University,Harbin 150081,China.

Background:Safflower is a traditional medicine that is widely used to treat various diseases.Safflower polysaccharide is one of the effective constituents of safflower.This study explored the anti-tumor effect of safflower polysaccharide and its possible mechanism.Methods:The MTT assay was used to detect the proliferation of hepatocellular carcinoma cells (SMMC-7721 cells).We observed cell apoptosis with a fluorescence microscope.And we used qRT-PCR and western blot to detect the expression of cell cycle related factors.Results:Safflower polysaccharide could inhibit the growth of SMMC-7721 cells in a dose-dependent manner and induce its apoptosis.Compared with the blank group,the cell proliferation-related protein of CDC25B and Survivin were down-regulated in SMMC-7721 cells treated with safflower polysaccharide,while the cell apoptosis-related protein levels of P53 and P38MAPK were up-regulated (P ＜ 0.05).In addition,safflower polysaccharide inhibited the protein levels of CDC2 (P ＜ 0.05).Conclusion:Safflower polysaccharide can inhibit the growth of hepatocellular carcinoma cells by inhibiting proliferation and promoting apoptosis，and the P38MAPK pathway may play an important role in this process.

Key words:SPS,Hepatocellular carcinoma cells,P38MAPK pathway

Background

Hepatocellular carcinoma (HCC) is one of the most common causes of tumor-related death in the world.In recent years,the incidence of HCC has increased greatly.According to reports,HCC accounts for approximately 6% of all new cancer cases,and nearly 1% of deaths in the world are related to HCC [1].In 2012,there are about 782,000 new cases of HCC and 745,000 deaths [2].Among the 600,000 cases of HCC reported worldwide,Asian countries account for more than 70% [3].Although a variety of clinical drugs have been used in the treatment of HCC and have promoted the development of chemotherapy,their toxic side effects and drug resistance still limit the effectiveness of clinical drug applications.Therefore,it is particularly important to choose more effective and safer anti-tumor drugs.Honghua (Carthami flos)(Compositae) [4],a widely used traditional Chinese medicine,is known as safflower.Our research team proved that SPS isolated from safflower could inhibit the development of HN-6 cells,HeLa cells,SGC-7921 cells,NSCLC cells,MCF-7 breast cancer cells and liver cancer cells [5-12].

There are four phases in cell cycle,such as G1,S,G2 and M phase.CDC2-CyclinB1 complex is critical for the completion of G2/M transition [12].CDC2-CyclinB1 complex belongs to cyclin-dependent kinase complexes,which are activated by CDC25 phosphatases.There are 3 homologues of CDC25 in human body,such as CDC25A,CDC25B and CDC25C [13].In early studies,CDC25A regulates the transition of the G1/S cell cycle,and the others regulate mitosis.However,recent studies have shown that they are all involved in the phase transition and mitosis of G2/M and G1/S [14,15].CDC25B plays a very important role in cell arrest induced by G2/M checkpoint.Many upstream genes affect the expression ofCDC25Bgene.Therefore,in this experiment,SMMC-7721 cells were selected as the experimental object to study the anti-tumor mechanism of SPS.

In our previous studies,we mainly studied the effect of SPS on the inhibition of proliferation and the induction of apoptosis of SMMC-7721 cells [10].SPS showed anti-proliferative activity in cells of HCC,and induced SMMC-7721 cell cycle arrest in G2/M phase[11,12].This study will further investigate the possible mechanisms involved in this process of cell cycle arrest and apoptosis.

Methods

SPS preparation

TheCarthamus tinctoriusL.was purchased from Wanshoutang Co.,Ltd.(Harbin,PR China),and voucher specimens (NO.HLJ-20120928).The safflower was dyed at 60 ℃ and extracted 4 times in water.The compound was precipitated with 4 times volumes of 95% ethanol at 4 ℃for 1 day.The mixture was centrifuged and dissolved by water twice.The 1:4(v/v) mixture of n-Butyl alcohol and Chloroform extracted the protein of polysaccharide.The extraction rate of SPS was 0.382% [5,6,16].SPS is water-soluble and dissolved in cell culture medium for administration.

Chemicals and cell culture

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT),dimethyl sulfoxide (DMSO),antibodies against GAPDH,CDC25B,P53,Survivin,P38MAPK and p-P38MAPK were purchased from RabMAb.Cell division cycle (CDC)2 antibody was purchased from Boster company.The human hepatocarinoma SMMC-7721 cells were grown in 90%RPMI 1640 and 10% fetal bovine serum purchased from NQBB company at 37 ℃ under a humidified,5%CO2atmosphere.

Cell proliferation assay

The cell proliferation assay was determined by measuring MTT dye absorbance of living cells.In brief,1 × 104cells were plated in 96-well culture plants and treated with vehicle alone (0.1% DMSO)and different concentrations of SPS for 24 and 48 h.Twenty μL MTT solution (5 mg/mL) added into every well and incubated at 37 ℃ for 4 h.The precipitation of every well was dissolved in 150 μL DMSO.The absorbance at 570 nm was determined in every well with the microplate reader (Multiskan Mk3,US).

Detection of intracellular ROS

In the experiment,cells incubated in 6-well plate treated by various concentration SPS and 3.9 mg/L Epirubicin for 48 h.1 mL DCFH-DA (10 μM) put in each well and incubated at 37 ℃ for 20 min.Then the cells were washed by serum-free cell culture medium 3 times.DCF fluorescence was measured in a flow cytometer at 488 nm and 525 nm.

Immunofluorescence staining

The 5 × 105cells were planted in 12-well culture plants and treated with various concentration of SPS (0.16,0.32,0.64 g/L) for 48 h.Each well added 0.5 mL Hoechst33258 staining (Beyotime,China) for 30 min.The stain washed by PBS 3 times,and the cells were observed by fluorescence microscope (EVOS FL Auto,America).The mean fluorescence intensity data were measured by image J software.

Immunohistochemistry

2×104SMMC-7721 cells were grown on coverslips,and allowed to attach overnight.The cells were treated by SPS for 48 h,washed with PBS,and fixed with formaldehyde (10%) for 1 h.Later,the cells were incubated with regular rabbit serum for 45 min at indoor temperature.Cells were treated with Rabbit Anti-P38MAP kinase (1:60 dilution; Boster,cat.#BA1325),anti-CDC2(1:50 dilution;Boster,cat.#BM0027) antibodies overnight at 4 ℃.After washing with PBS,cells were treated with goat anti-mouse antibody (1:50 dilution;Beijing zhongshan reagent company,cat.#PV6001) for 0.5 h at indoor temperature.The cells were then treated with DAB for 10 min.Slides were mounted and observed by Leica microscope at × 100 magnifacation (objective lenses).

Effects of SPS on cell cycle-related gene expression

RNA was isolated from cells,which were treated with different concentrations of SPS (0.16,0.32,0.64 g/L)for 48 h.Whole RNA was isolated using TRIzol Reagent (Invitrogen company.cat.#15596-026).qRT-PCR was performed using primers forGAPDH,P53,CDC25B,SurvivinandP38MAPKas previously.Briefly,2μL of denatured whole RNA was reverse transcribed in a total volume of 20 μL of reaction mixture containing 1.25 μL of reverse primers,DEPC-H2O 11.5 μL,4 μL of 5 × RT buffer,0.5 μL(100 U) of RNase inhibitor and 10 mM dNTPs mix,at 42 ℃ for 30 min.Then,we heated it at 85℃ and finished the reaction on ice.We used 2 μL of cDNA for PCR amplification in a reaction volume of 20 μL comprising 0.1 μL of each specific primer and 0.2 μL of TAQ enzyme(5U/μL),DEPC-H2O to 20 μL.The PCR reaction was conducted at 95℃for 3 min with a thermal cycler (IQ5 real-time PCR Instrument,Bio-rad,US).Finally,the reaction was terminated at 62 ℃.The specific primer pairs for this study were:GAPDH:CATGAGAAGTATGACAACAGCCT and AGTCCTTCCACGATACCAAAGT (113bp);P53:CTATGAGCCGCCTGAGGTT and AGCTGTTCCGTCCCAGTAGAT(152bp);CDC25B:TTCATCAGGGAACGAGACCGTG and TTCACAGAAGTTCGGGTGCTGAG(117bp);Survivin:AGCCAGATGACGACCCCATAGAG and TGTTCTTGGCTCTTTCTCTGTCCAG(132bp);p38MAPK:AGAGGCCCACGTTCTACCG and TTCGCATGAAT GATGGACTGA (187bp).

Western blot assay

After being treated with various concentration of SPS,cells were lysed in cell lysis buffer on ice.About 1 mM pheylmethylsulfony fluorie was added into lysis buffer.After the cell lysates were centrifuged with 20,000 g for 30 min,protein concentration was determined with Bradford method.Protein samples were then subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto the polyvinylidene difluride membrane.The membrane was blocked in 5% non-fat milk in Tris-buffered saline with 0.1%Tween20 for 2 h and then incubated with primary antibody and subsequently with appropriate goat rabbit Irdye 800 cw fluorenscent secondary antibody (Li-Cor,926-32211).

Statistical analysis

The experiments data were presented as the mean ±standard deviation (X±s) and analyzed by t-test for further between-group comparisons. Statistical significance was accepted atP＜ 0.05.

Results

SPS had inhibitory effect on SMMC-7721 cells proliferation

We examined the effect of SPS on the inhibition of proliferation of SMMC-7721 cells using MTT assay.After exposure to SPS for 24 and 48 h respectively,the growth of SMMC-7721 cells were dose-dependently decreased with an IC50of approximately 0.790 g/L at 48 h.When the dose of SPS is 1.28 g/L,the growth rate of SMMC-7721 cells increased (Table 1).

Effect of SPS on ROS production in SMMC-7721 cells

The changes in intracellular ROS levels were investigated in SMMC-7721 cells treated with SPS.Figure 1,all the tested doses of SPS did significantly alter the intracellular ROS (DCF) level in SMMC-7721 cells at 48 h.The mean DCF fluorescence of 0.16,0.32,and 0.64 g/L SPS was 83.67,111.00 and 188.5.However,the group of cells treated with EPI did not obviously change compared with 0.16 g/L SPS.To discover whether the main reason of G2/M arrest is ROS generation in SMMC-7721 cells treated with SPS.G2/M cycle-related genes were the focus in the further experiment.

The promoting effect of SPS on cell apoptosis

A Hoechst 33258 staining experiment was used to observe apoptosis cells.After the cells treated SPS for 48 h,the typical morphological changes were found,such as chromatin fragmentation and nuclear shrinkage(Figure 2).The bar graphs illustrated mean fluorescence intensity data,which shown the apoptosis cells increased with the dose-dependent.

Cell cycle- related gene expression

In our previous studies,SPS inhibits the proliferation and the best dose is 0.64 g/L.The SMMC-7721 hepatic cancer cell arrested at G2/M phase,and CyclinB1 protein decreased [11].Cell cycle was arrested at G2/M phase and induction of apoptosis occurred in SMMC-7721 cells upon drug exposure.In the IHC experiment,after SMMC-7721 cells were treated by SPS for 48 h,CDC2 protein expression decreased.P38MAPK protein increased (Table 2).CDC25BandSurvivinmRNAs decreased by qRT-PCR analysis.However,P53andP38MAPKmRNAs increased(Figure 3).The proteins of P53,P38MAPK,P38MAPK phosphorylation (p-P38MAPK),CDC25B and Survivin were measured by western blotting.SPS caused a dose-dependent increase in P53,P38MAPK,p-P38MAPK and p-P38MAPK/ P38MAPK ratio (P＜0.05).On the contrary,Survivin and CDC25B protein expression down-regulated (P＜ 0.05).The results were similar to the results of qRT-PCR.These data were shown in Figure 3,4.

Discussion

Cell division is accompanied by the cell cycle,and the cell cycle has a complex regulatory role in the development of cancer.We previous reported SPS inhibited the proliferation of SMMC-7721 cell and arrested in G2/M phase [10-12].In cell cycle experiments,cells were treated with different concentrations of SPS,stained with propidium iodide,and analyzed by flow cytometry.As shown by flow cytometer analysis,exposure to the higher concentrations of SPS,the proportion of SMMC cells in the G2/M phase increased significantly.Cell cycle arrest is a goal for cancer.The cell cycle can be affected by many factors.The mechanism of SMMC-7721 cell arrest was unclear,which is the aim of this study.

P38 mitogen-activated protein kinase (P38MAPK)signaling pathway mediates inflammatory reactions and metastasis,which plays a dual role in cell death and survival.The results of this study indicate that SPS has an impact on the generation of ROS and the expression of cell cycle-related genes.ROS maybe involve in the DNA damage process of cancer cells and caused G2/M arrest [17].ROS may activateP38MAPKgene and protein expression.In thisexperiment,P38MAPKgene expression up-regulated,and meanwhile ROS increased.ROS maybe activate P38MAPK signaling pathway and inhibitCDC25Bgene expression.In cell cycle,the entry into mitosis is regulated by the CDC2/CyclinB1 complex (M-phase promoting factor) (Figure5).CDC2 is a sub-unit of M-phase promoting factor,which over-expressed in various tumors and was activated by CDC25B.In this study,CDC2 protein,CDC25BmRNA and protein were over-expressed in SMMC-7721 cells.SPS decreased the genes expression in a dose dependent manner,which induced SMMC-7721 cells growth arrested in G2/M phase.Cell apoptosis happened simultaneously examined with Hoechst33258 staining.In addition,SPS may directly activate P38MAPK signaling pathway to enhance the role of cell cycle arrest.SPS may contribute to the expression ofP53gene,which inhibits binding of dual CDC2 and CyclinB1.P53gene activation may also be caused by drugs undermine the stability of DNA,or increased ROS damage the integrity of the DNA.In the meantime,P53gene expression in turn stimulates the production of ROS,which form positive feedback.Expression ofP53gene will activate its downstream cell cycle inhibitoryP21andGADD45ɑ,which induces cell cycle arrest [18].P53orP21downregulates the expression ofP53-repression target gene (such asCDC25B) to induce cell-cycle arrest [19,20].We found a negative correlation betweenP53andSurvivin.Overexpression ofSurvivingene in tumor cells and normal cells is an important distinction [21],therefore Survivin is one target for inhibiting the apoptosis inhibitor.Survivinprotects cancer cells from cell death and contributes to cancer progression.WhenP53gene activation increased or expression up-regulated,Survivinwas inhitbited [22].Survivinis expressed in the G2/M phase and also involves in G2/M phase cell cycle arrest [23].This experiment confirmed that SPS downregulatedSurvivinand up-regulatedP38MAPKandP53gene expression,which indicated the relationship between the three genes.Various factors of the network cross are the combined effects of SPS in SMMC-7721 hepatoma cell growth arrest in G2/M phase (Figure 6).In conclusion SPS maybe play an anti-tumor role through activating P38MAPK signaling pathway.

Figure 1 Flow cytometry was used to detect the level of intracellular ROS production after 48h of different concentrations of SPS.1:blank control;2:treated with 0.16 g/L SPS;3:treated with 0.32 g/L SPS;4:treated with 0.64 g/L SPS;5:treated with 3.9 mg/LEpirubicin.*Statistically significant difference compared with the blank control (P ＜ 0.05).SPS,safflower polysaccharide.

Figure 2 The hoechst33258 staining method (× 400) was used to observe the effect of different concentrations of SPS on the apoptosis of SMMC-7721 cells.1:blank control;2:treated with 0.16g/L SPS;3:treated with 0.32 g/L SPS;4:treated with 0.64 g/L SPS.SPS,safflower polysaccharide.

Table 1 The inhibition effect of SMMC-7721 cells treated by SPS (X ± s,n = 6)

Table 2 Mean optical density of CDC2 and P38MAPK in SMMC-7721 cells (X ± s,n = 6)

Figure 3 SMMC-7721 cells were treated with various concentrations of SPS for 48 h.Note:the method was used for qRT-PCR.1:blank control;2:treated with 0.16g/L SPS;3:treated with 0.32 g/L SPS;4:treated with 0.64 g/L SPS.Each experiment was performed at least three times independently,and results were comparable.SPS down-regulated the protein level of CDC2 and P38MAPK.*,Statistically significant difference compared with the blank control (P ＜ 0.05).SPS,safflower polysaccharide.

Figure 4 SPS treatment modulates cell cycle regulatory proteins.SMMC-7721 cells were treated with different dose of SPS for 48 h.The method is used for western blot.Each experiment was performed at least three times independently,and results were comparable.(1):blank control;(2):treated with 0.16g/L SPS;(3):treated with 0.32 g/L SPS;(4):treated with 0.64 g/L SPS.SPS,safflower polysaccharide.

Figure 5 cell cycle

Conclusion

SPS can increase the level of ROS in SMMC-7721 cells and up-regulate the expression ofP38MAPKgene.SPS may induce SMMC-7721 cell cycle arrest in G2/M phase by promoting the P38MAPK signaling pathway.These effects are related to the regulation of G2/M cell cycle-related genes.

Figure 6 Schematic diagram of SPS-induced hepatic cancer cell cycle arrest.SPS,safflower polysaccharide.