APP下载

Expression of P-gp and miRNA-21 in Colorectal Cancer Tissues and the Clinical Significance

2021-01-13XiaoliYANPengYANYanfangFANJingXUEMingjuanWANGJiningZHENG

Medicinal Plant 2020年6期

Xiaoli YAN, Peng YAN, Yanfang FAN, Jing XUE, Mingjuan WANG, Jining ZHENG

Chengde Medical University, Chengde 067000, China

Abstract [Objectives] To study the expression of P-gp and miRNA-21 in colorectal cancer tissues and the relationship between the expression of P-gp and clinicopathological features, and to analyze the correlation between the expression of miRNA-21 and P-gp. [Methods] Immunohistochemical SP method was used to detect the expression level of P-gp in the tissues of 40 cases of colorectal cancer and the normal mucosal tissues 5 cm away from the corresponding cancer tissues, and the expression level of miRNA-21 in the paraffin tissues of the 40 cases was detected by RT-qPCR. [Results] The positive expression of P-gp was localized in the cell membrane, and the expression in colorectal cancer tissues was significantly higher than that in the corresponding adjacent tissues (P<0.05); the positive expression of P-gp was closely related to the degree of tumor differentiation and the depth of invasion (P<0.05), and the comparison results of P-gp expression in the differentiation groups of different cancer tissues showed that the expression level of P-gp in the moderately and poorly differentiated groups was significantly higher than that in the highly differentiated group (P<0.05), and the expression level of the moderately and poorly differentiated groups was similar (P>0.05). The expression of miRNA-21 in all cancer tissues was higher than that in the corresponding adjacent tissues (P<0.05), and the expression levels of miRNA-21 in differentiation groups of different cancer tissues were 1.286, 1.445 and 1.992 times of those in the corresponding adjacent tissues, respectively; the comparison results of miRNA-21 between different differentiation groups showed that the expression level of miRNA-21 in the poorly differentiated group was significantly higher than that in the highly differentiated group and the moderately differentiated group (P<0.05), while the expression level of miRNA-21 in the highly differentiated group and the moderately differentiated group was similar (P>0.05). Spearman correlation analysis showed that there was a positive correlation on the expression between the two in colorectal cancer tissues (r=0.423, P<0.05). [Conclusions] The expression levels of miRNA-21 and P-gp are closely related to the differentiation degree of clinical colorectal cancer, the lower the differentiation degree, the higher the expression level of the two.

Key words Colorectal cancer, P-gp, miRNA-21

1 Introduction

According to the global cancer statistics of the international agency for research on cancer in 2018, the number of new cases of colorectal cancer is the fourth and the number of deaths is the fifth in the world[1]. Chemotherapy is one of the main strategies for the treatment of middle and late colorectal cancer, but the drug resistance of tumor cells to chemotherapy drugs is an important reason for the failure of chemotherapy. Multidrug resistance (MDR) is related to the overexpression of P-glycoprotein (P-gp) coded by MDR gene ABCB1 (ATP binding cassette B1). Therefore, MDR of tumor cells can be reversed by inhibiting the expression of P-gp. In recent years, it has been found that microRNAs (miRNAs) are related to the generation of tumor MDR. MiRNAs are a class of non-coding small molecular RNAs, which can regulate the expression of target genes at the post-transcriptional level by binding to the 3-noncoding regions of corresponding target genes. Some studies have shown that miRNAs are involved in many biological processes of cells[2]. Moreover, many studies have shown that the abnormal expression of miRNAs is closely related to the prognosis of cancer patients[3-4]. A search of the RNA 22 tool database revealed that miRNA-21 and ABCB1 have complementary base sequence pairs, suggesting that the expression of miRNA-21 may be related to the expression of P-gp. Therefore, 40 cases of colorectal cancer tissues and corresponding 40 cases of normal colorectal mucosal tissues 5 cm away from the cancer were taken as the research objects in this study to detect the expression of miRNA-21 and P-gp, and the expression levels and correlations of the two in colorectal cancer tissues were discussed.

2 Materials and methods

2.1 Research materials40 paraffin specimens of patients with colorectal cancer undergoing radical resection in the Affiliated Hospital of Chengde Medical University from January 2015 to January 2016 have been collected; the age of the patients ranged from 35 to 86 years old, with a median age of 58.5 years; there were 27 males and 13 females; 15 patients were well differentiated, 19 patients were moderately differentiated and 6 patients were poorly differentiated. All patients did not receive chemotherapy and radiotherapy before operation, the clinicopathological data were complete, and the pathological diagnosis of colorectal cancer was made by paraffin section after operation. One piece of tumor tissue and one piece of normal mucosa tissue more than 5 cm away from the edge of tumor were taken from each surgical specimen.

2.2 Main reagentsMouse anti-human monoclonal antibody (MA1-26529) was purchased from Invitrogen Technology Company; Biotin-Streptavidin HRP immunohistochemical kits (SP-9000) and DAB chromogenic kits (ZLI-9018) were both purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; total RNA purification kits of Formalin fixed paraffin-embedded tissue (FFPE), standardized RT-PCR quantitative kits of Hairpin-it TM microRNA and snRNAU6 were all purchased from Suzhou Genepharma Co., Ltd.

2.3 Research methods

2.3.1Immunohistochemistry. Paraffin tissue specimens were sectioned consecutively into 5 μm thickness and stained with immunohistochemical SP method. The diluted concentration of P-gp primary antibody was 1∶50, the experimental procedures were carried out in strict accordance with the instructions of the kit, PBS was used to replace the primary antibody as the blank control, the known negative sections were used as the negative control, and the known positive sections were used as the positive control.

2.3.2Real-time fluorescent quantitative polymerase chain reaction for reverse transcription (RT-qPCR). Firstly, total RNA was extracted from paraffin tissue. All paraffin tissues were sectioned consecutively into 15-20 pieces according to the thickness of 10 μm, the total area of cancer tissue and normal mucosal epithelium reached more than 300 mm2, respectively. The cancer tissue and the corresponding normal tissue were respectively collected into EP tubes for RNA extraction after conventional baking, xylene dewaxing and ethanol elution. The RNA extraction procedure was carried out according to the instructions of the kit. The concentration was detected by NanoDrop 2000 spectrophotometer, the purity of the sample A260/A280was within the range of 1.8-2.1, which was considered to meet the standard. Reverse transcription and amplification were performed by using Hairpin-it miRNAs qRT-PCR quantitative kit with SYBR dye method, and U6 snRNA was used as the internal reference. Both the reverse transcription reaction system and PCR reaction system were 20 μL, the reaction procedure was carried out strictly according to the instructions. The amplimer sequence for miRNA-21 was as follows: forward TCGCCCGTAGCTTATCAGACT, reverse CAGAGCAGGGTCCGA GGTA, the amplified fragment was 70 bp; the amplimer sequence of U6 snRNA was: forward ATTGGAACGATACAGAGAAGATT, reverse GGAACG CTTCACGAATTTG, the amplified fragment was 87 bp.

2.4 Determination of results

2.4.1Determination of immunohistochemical results. The positive expression of P-gp was yellow granules. The staining results were read by two senior pathologists with double-blind method and the following semi-quantitative judgment criteria were used for interpretation: first, the dyeing intensity was graded as follows: 0 was colorless, 1 was light yellow, 2 was brownish yellow, and 3 was brown; then, the percentage of positive cells was scored: 0 was negative, 1 was positive cells ≤10%, 2 was 11%-50%, and 3 was 51%-75%, 4 was > 75%. If the product of staining intensity and percentage of positive cells was more than 3 points, the immune response would be counted as (+), otherwise it would be judged as (-). In addition, the positive expression closely related to the pathological parameters in clinicopathological characteristics was analyzed by MiVnt microscopic image again, after determining the staining intensity of positive cells, the immune results were comprehensively determined according to the area occupied by positive cells: 10 high-power visual fields were randomly selected from each section, < 5% was negative (-); 5%-20% was weakly positive (+), and > 20% was strongly positive (++).

2.4.2Determination of qRT-PCR results. In each experiment, miRNA-21 and U6 were set with three multiple pores, and the experiment was repeated for three times. The Ct value should not be greater than 30, and the difference between multiple pores of each sample should not be greater than 1. The experimental results were analyzed by 2-ΔΔCtrelative quantitative analysis, in which ΔΔCt=(Ct target gene-Ct internal reference gene)experimental group-(Ct target gene-Ct internal reference gene)control group, 2-ΔΔCtindicated that the expression level of miRNA-21 in cancer tissue was multiple of that in normal mucosa tissue, 2-ΔΔCt<1 indicated that the expression of miRNA-21 in cancer tissue was lower than that in normal tissue, and > 1 indicated that the expression of miRNA-21 in cancer tissue was higher than that in normal tissue.

2.5 Statistical analysisSPSS 19.0 software was used for statistical analysis, Chi-square (x2) test was used for counting data and four-grid table data, pairedttest was used for paired data; andLSD-ttest was used for multiple comparisons between multiple sample means. Spearman correlation analysis was used to analyze the correlation between the factors.P<0.05 indicated that the difference was statistically significant.

3 Results and analyses

3.1 The expression of P-gp in colorectal cancer tissues and adjacent normal tissues and its relationship with clinicopathological featuresThe positive expression of P-gp was mainly located in the cell membrane, which was yellow granules. P-gp was expressed in adjacent normal tissues (Fig.1A) and in colorectal cancer tissues (Fig.1B was highly differentiated, C was moderately differentiated, D was poorly differentiated) with different differentiation degrees. The positive expression of P-gp was closely related to the degree of tumor differentiation and the depth of infiltration, and the difference was statistically significant (P<0.05), but it was not related to the gender, age, site of onset, tumor morphology or lymph node metastasis of the patients (Fig.1 and Table 1).

3.2 The expression of P-gp in colorectal cancer tissues with different degrees of differentiationIn the highly, moderately and poorly differentiated groups (Table 2), the staining intensity and positive cells area of P-gp expression in cancer tissues were significantly higher than those in adjacent normal tissues, and the differences was statistically significant (P<0.05); in cancer tissues, the expression of P-gp in the moderately and poorly differentiated groups was significantly higher than that in the highly differentiated groups, the differences was statistically significant (P<0.05);the staining intensity of P-gp expression and the area of positive cells in the moderately and poorly differentiated groups were similar, and the difference was not statistically significant (P>0.05).

Note: A. Normal colorectal mucosal tissues; B. Highly differentiated colorectal cancer tissues; C. Moderately differentiated colorectal cancer tissues; D. Poorly differentiated colorectal cancer tissues (×200).

Table 1 The relationship between P-gp expression and the clinicopathological features of colorectal cancer patients

Table 2 The positive area of P-gp expression in colorectal cancer tissues and adjacent normal tissues

3.3 The expression of miRNA-21 in colorectal cancer tissues and adjacent normal tissuesThe expression of miRNA-21 in all cancer tissues was higher than that in adjacent normal tissues, and the difference was statistically significant (P<0.05). The expression levels of miRNA-21 in the groups with different degrees of differentiation cancer tissues were 1.286, 1.445 and 1.992 times of those in the corresponding adjacent normal tissues, respectively, and the differences were statistically significant (P<0.05); in cancer tissues, the expression of miRNA-21 in poorly differentiated group was significantly higher than that in highly and moderately differentiated groups, and the difference was statistically significant (P<0.05), the expression levels of miRNA-21 in highly and moderately differentiated groups were similar, and the difference was not statistically significant (P>0.05). As the degree of differentiation decreased, the expression level of miRNA-21 gradually increased (Table 3).

3.4 The correlation between P-gp expression and miRNA-21 expression in colorectal cancerFor miRNA-21 expression in cancer tissues compared with the variation multiples of normal mucosal epithelium, 2-ΔΔCt≥1 was positive, 2-ΔΔCt<1 was negative (Table 4). Spearman correlation analysis showed that miRNA-21 expression was positively correlated with P-gp expression in colorectal cancer tissues (r=0.423,P=0.041).

Table 3 The relative expression level of miRNA-21 in colorectal cancer tissues compared to adjacent normal tissues

Table 4 The correlation of expression levels of P-gp and miRNA-21 in colorectal cancer tissues

4 Discussions

The resistance of tumor cells to anticancer drugs is an important reason for chemotherapy failure. At present, it has been confirmed that the high expression of P-gp is related to chemotherapy resistance of many tumors[5], including colorectal cancer. P-gp is the most characteristic member of ABC transporter family, it can reduce the intracellular drug concentration by ATP-mediated drug efflux pump, which makes cancer cells form multidrug resistance phenotype, and then develop resistance to chemotherapy drugs. In this study, the relationship between P-gp expression and clinicopathological characteristics of colorectal cancer was analyzed by immunohistochemistry, it was found that the positive expression rate of P-gp was closely related to the degree of differentiation and depth of invasion of colorectal cancer, it was speculated that the lower the degree of differentiation and the deeper the invasion of colorectal cancer, patients are more likely to develop chemotherapy resistance. Therefore, reducing the expression of P-gp and inhibiting its function can inhibit the formation of MDR phenotype. However, the clinical application of P-gp inhibitors is limited because of its known or unpredictable side effects and other defects in clinical trials. In recent years, the experimental studies on improving the clinical chemotherapeutic resistance by lowering the expression of P-gp have been still in progress. Some studies[6-7]have shown that the expression of miRNA-21 is increased in tumor tissues, including colorectal cancer. Moreover, many studies[8-9]have shown that miRNA-21 is related to tumor MDR, however, it is not clear whether the relationship between miRNA-21 and MDR is related to P-gp in colorectal cancer. Therefore, the expression of miRNA-21 and P-gp in normal colorectal tissues and cancer tissues with different degrees of differentiation were detected in this study to explore the relationship between them and the degree of differentiation of colorectal cancer as well as the correlation between their expression level. The results showed that miRNA-21 and P-gp were closely related to the degree of differentiation of colorectal cancer; although the statistical analysis results of miRNA-21 and P-gp in different differentiation groups were not completely consistent, the reason may be that the statistical analysis results were different due to the small sample size, but with the reduction of differentiation degree, the expression levels of miRNA-21 and P-gp were gradually increased, and the correlation analysis results showed that the expression of miRNA-21 and P-gp was positively correlated. However, in the later stage, it is necessary to further collect tissue samples for larger sample size experiments in order to reduce the experimental errors, and carry out cell level experiments to study whether miRNA-21 can directly regulate the expression of P-gp, and further explore the mechanism of their involvement in multidrug resistance in colorectal cancer.

In conclusion, the expression levels of P-gp and miRNA-21 are closely related to the differentiation degree of clinical colorectal cancer; the lower the differentiation degree, the higher the expression level of the two; miRNA-21 may cooperate with P-gp to participate in the formation of MDR phenotype of colorectal cancer, and the two may be jointly used as important indicators to judge the clinical chemotherapy resistance of colorectal cancer.


登录APP查看全文