Aptamer-Based Fluorescent Assay for Sensitive Detection of Cardiac Troponin I
2020-04-21YuLiYuanzhanYangXuefeiandYulinDeng
Yu Li, Yuanzhan Yang, Xuefei Lü and Yulin Deng
(School of Life Science, Beijing Institute of Technology, Beijing 100081, China)
Abstract: Acute myocardial infarction (AMI) is a major health problem leading to high rates of mortality and morbidity. Biomarker cardiac troponin I (cTnI) has shown high sensitivity and specificity towards AMI detection, and has been regarded as “gold standard”. An ultrasensitive method to detect cTnI with low concentration in human fluid is essential. In this paper, we developed an aptamer-based assay coupled with rolling circle amplification (RCA) and molecular beacon probe for sensitive detection of cTnI. In this strategy, aptamer acts as a bridge to communicate between oligonucleotides and cTnI. RCA reaction produces a single-stranded tandem repeated copy of the circular template, which are recognized by fluorescence molecular beacon probe. With this strategy, highly sensitive and specific detection of cTnI was realized with the lowest detectable concentration of 7.24 pg/mL. The developed aptamer-RCA assay can be a promising tool in clinical samples analysis. The assay can also analyze other disease-related biomarkers by replacing the aptamer.
Key words: aptamer; cardiac troponin I (cTnI); molecular beacon; rolling circle amplification; sensitive detection
As a major health problem, acute myocardial infarction (AMI) leads to high rates of mortality and morbidity. In recent years, rapid and accurate diagnosis and prognosis of AMI are drawing attention, and appropriate biomarkers are needed[1]. The commonly used biomarkers include myoglobin, creatine-kinase MB, C-reactive protein, and cardiac troponin, and so on. Cardiac troponin I (cTnI) showed higher sensitivity and specificity than other biomarkers, and has been regarded as “gold standard” mainly due to its solely expression in cardiomyocytes[2].
The concentration of cTnI is below 0.06 ng/mL in normal patients, but increases to 100-1 300 ng/mL in some AMI patients[3]. As a powerful method, antibody-based enzyme-linked immunosorbent assay (ELISA) has been used to detect cTnI levels in clinical setting[4]. Although ELISA is highly specific and reproducible, the limit of detection (LOD) is at the ng/mL level, which makes it unsuitable to detect cTnI with concentration far below this LOD . Studies have been carried out to improve the sensitivity of immunoassays for cTnI detection. Kim et al.[5]developed gold nanoparticle-based enhanced sandwich immunoassay for highly sensitive detection of cTnI, and as low as 15 pg/mL of cTnI in human serum can be detected. Lee et al.[6]presented a lab-on-a-disc composed of a TiO2nanofibrous mat for sensitive detection of C-reactive protein (CRP) and cTnI with the detection limit of 0.8 pg/mL and 37 pg/mL, respectively, which are about 300-fold lower than those in the conventional ELISA. Zhou et al.[7]developed electrochemical immunosensor on microfluidic chips for simultaneous detection of CRP and cTnI based on ELISA in poly(dimethylsiloxane)-gold nanoparticle composite microreactors. The detection limit was approximately 0.004 ng/mL for cTnI and 0.22 ng/mL for CRP.
DNA possesses such properties as ease of synthesis, modification, manipulation, and amplification. In recent years, combining the unique properties of DNA with the general principles of ELISA, DNA-based immunoassays, such as immuno-polymerase chain reaction (IPCR), immuno-rolling circle amplification (IRCA), and proximity ligation assay (PLA), have been shown to be more sensitive than the conventional ELISA[8].
Compared to PCR, isothermal amplification (i.e. RCA) can be performed without precise control of cycling temperature and has been developed as a powerful method for nucleic acids quantification[9]. As one of DNA-based immunoassays, immuno-RCA was firstly developed by Schweitzer et al.[10]using an oligonucleotide primer labeled anti-human immunoglobulin E (IgE) antibody. The LOD was 0.1 ng/mL, which were about two orders of magnitude lower over conventional ELISA. Until now, immuno-RCA has been widely used to detect different protein targets with higher sensitivity[11-15].
A significant challenge for immuno-RCA is the coupling of DNA oligomers with antibodies, which restricted its wide application to some extent. The appearance of more easily produced oligonucleotide affinity reagents such as aptamers, helps to further promote the development of immuno-RCA[8].The primer sequence of RCA can be easily conjugated with aptamer through chemical synthesis[16-18], and aptamer based immuno-RCA assays have been developed for sensitive and specific detection of target proteins combining with the detection modes of colorimetry[11,19], chemiluminescence[12,20], fluorescence[10], and electrochemistry[16], and so on. However, the aptamer based immnuo-RCA method for the sensitive detection of cTnI in human fluids has not been reported.
In the present study, based on the selected DNA aptamers against human cTnI[3], an aptamer based immuno-RCA assay combining fluorescent probe was developed for sensitive detection of low concentration cTnI in human fluids.
1 Experimental
1.1 Materials and chemicals
Human cardiac troponin I (cTnI), anti-human cTnI antibody, and myoglobin were ordered from Abcam Inc. (Cambridge, USA). T4 DNA ligase and Phi29 DNA polymerase were obtained from NEB (UK). Bovine serum albumin (BSA), DNA ladder, and deoxyribonucleoside 5′-triphosphate mixture (dNTP) were purchased from Solarbio (Beijing, China). Human serum albumin (HSA) was purchased from Sigma Aldrich (USA). Horseradish peroxidase (HRP) -labeled streptavidin and 3,3′,5,5′-tetramethylbenzidine(TMB) were obtained from Beyotime (Jiangsu, China). Human cTnI ELISA kit was purchased from Thermo Fisher (USA). Glucose and other chemicals were obtained from Beijing Chemical Industry Group CO., LTD (Beijing, China). All solutions were prepared using ultrapure water, which was purified and deionized with a Milli-Q system (Millipore, America).
DNA oligonucleotides were synthesized and purified by Sangon Biotech Co., Ltd. (Shanghai, China). Biotinylated cTnI aptamer, 5′-biotin-GCCTGTTGTGAGCCTCCTAACTACATGTTCTCAGGG TTGAGGCTGGATGGCGATGGTGGCATGCTTATT CTTGTCTCCC-3′. Aptamer-primer complex, 5′-GCCTGTTGTGAGCCTCCTAACTACATGTTCTCAG GGTTGAGGCTGGATGGCGATGGTGGCATGCTTA TTCTTGTCTCCCTTTTTTGTCCGTGCTAGAAGGAAACAGTTAC-3′ (the underlined portion is the aptamer sequence of cTnI and the italicized portion is the primer sequence). Padlock probe, 5′-TAGCACGGACATATATGATGGACCGCAGTATGA GTATCTCCTATCACTACTAAGTGGAAGAAATGTA ACTGTTTCCTTC-3′. Molecular beacon, 5′FAM-CGCCTCTATGAGTATCTCCTATCAGAGGCG-3′Dabcyl. Complementary sequence of molecular beacon, 5′-GTAGTGATAGGAGATACTCATACTGC-3′.
1.2 Apparatus
Fluorescence signals were recorded by Cytation 3 cell imaging multi-mode microplate reader (Biotek, USA). RCA products were characterized by agarose gel electrophoresis (Biorad, USA).
1.3 Antibody coating
A 96-well microplate (Corning, USA) was coated with 100 μL of anti-cTnI solution diluted by coating buffer (pH 9.4, 15 mM Na2CO3and 35 mM NaHCO3), and was incubated at 4 ℃ overnight. After that, the microplate was washed three times with 300 μL of washing buffer (PBST, pH 7.4, 0.15 M NaCl,7.6 mM NaH2PO4, 2.4 mM Na2HPO4, and 0.05% Tween-20).
1.4 Preparation of cyclization product
50 μL of cyclization system includes 5 μL of 1 μM aptamer-primer complex, 5 μL of 1 μM padlock probe, 0.5 μL of T4 DNA ligase, 5 μL of T4 DNA ligase buffer, and deionized water. After incubation at 37 ℃ for 2 h, the cyclization system was heated on the boiling water bath for 10 min. The resulting cyclization product could be used directly or stored at -20 ℃ until use.
1.5 Immunoreactionin microplate wells
100 μL of cTnI at gradient concentrations (0,50,75, 100, 150, 250, and 500 pg/mL) were added into the microplate coated with anti-human cTnI antibody, and was incubated at 37 ℃ for 1 h. After washing three times with 300 μL of PBST, 50 μL of cyclization product was added into each well and was incubated at 37 ℃ for another 1 h. The resulting microplate wells were washed three times with 300 μL of PBST.
1.6 Rolling circle amplification (RCA)
60 μL of RCA reaction system including 0.2 μL of 10 U phi29 DNA polymerase, 6 μL of phi29 DNA polymerase buffer, 3 μL of 10 mM dNTP, and deionized water were added into each well of the microplate and incubated at 37 ℃ overnight. After that, the plate was washed three times with 300 μL of PBST.
1.7 Fluorescence measurement
100 μL of molecular beacon fluorescent probe at the concentration of 60 nM was added into the microwells contained RCA products, and the fluorescence intensity was measured after 1 h incubation at room temperature in the dark. Cytation 3 cell imaging multi-mode microplate reader (Biotek, USA) was used to record the fluorescence signals at the excitation wavelength of 492 nm and the emission wavelength of 520 nm.
2 Results and Discussion
2.1 Strategy of aptamer-based assay coupled with RCA and molecular beacon fluorescent probe

Fig.1 Schematic of aptamer-based assay by RCA combined with molecular beacon for sensitive detection of cTnI
Aptamer based RCA coupled with molecular beacon fluorescent probe was developed herein for sensitive detection of cTnI (Fig.1). In this strategy, anti-cTnI antibody coated on the 96-well microplate was used to capture cTnI. The pre-circularized product of aptamer-primer complex with padlock probe was added to capture cTnI specifically and form a sandwich structure. After adding phi29 DNA polymerase and dNTPs, a linear RCA reaction was initiated, and produced a single-stranded tandem repeated copy of the circular template. At the end of RCA amplification, molecular beacon labeled with fluorescein (FAM) and quencher (Dabcyl) was added into each microwell, the fluorescence signals at the excitation wavelength of 492 nm and the emission wavelength of 520 nm were measured. According to the fluorescence intensity, the concentrations of cTnI can be sensitively quantified.
2.2 Optimization of the concentration of coating antibody

Fig.2 Optimization of the concentration of coating antibody
A series of different dilution of antibody (1∶500,1∶1 000,1∶2 000, and 1∶4 000) were coated on the microplate, respectively. After blocked with BSA, 100 μL of 1 μg/mL cTnI was added. And then pre-circularized product of aptamer-primer complex with padlock probe was added to recognize cTnI. phi29 DNA polymerase and dNTPs were added to initiate RCA reaction. RCA amplification product was recognized by biotinylated probe (5′-biotin-GTTTCCTTCTAGCAC-3′), and after reaction with HRP-labeled streptavidin, TMB was added, and the absorbance value was detected at the wavelength of 450 nm (Fig.2). It can be found that with the increase of the dilution from 1∶500 to 1∶4 000, and the absorbance increased and then decreased, and the dilution of 1∶1 000 showed the highest absorbance. So 1∶1 000 was chosen as the optimized dilution of coating antibody and was used in the following experiment.
2.3 Affinity and specificity between cyclization product and cTnI
As for RCA reaction, the first step is the ligation of the aptamer-primer complex with padlock probe. Two strategies can be chosen, one is direct cyclization reaction on cTnI-coated microplate by adding aptamer-primer, padlock probe, and DNA ligase. The other is preparation of cyclization product in centrifuge tube by adding aptamer-primer, padlock probe, and DNA ligase, and the pre-prepared cyclization product was added on cTnI-coated microplate. Comparison with the former one, the latter can be easily prepared, and save a lot of time, but the affinity and specificity of the pre-prepared cyclization product with cTnI needs to be investigated.
The pre-prepared cyclization product was added on the cTnI-coated microplate for 1 h at 37 ℃, then HRP-labeled streptavidin was added. After reaction for 1 h at 37 ℃, TMB substrate solution was added for 5-30 min and the absorbance value at 450 nm was detected. In addition, the absorbance was compared with that of aptamer binding with cTnI.
The result shows that the absorbance value of cyclization product with cTnI was 1.53±0.11, similar with that of aptamer with the absorbance value of 1.46±0.06, indicating that cyclization product possessed similar affinity and specificity with cTnI compared with that of aptamer. In the following experiment, the cyclization product was prepared beforehand to save time.
2.4 Molecular beacon fluorescence probe design and performance analysis
The molecular beacon used in the present study consists of a stem-and-loop structure. The loop (15 nt) contains a sequence partly complementary to the RCA product, while the stem section contains complementary arm sequences, which is separately labeled with a fluorescein (FAM) and a quencher (Dabcyl). The molecular beacon probe exhibits efficient fluorescence quenching due to a close interaction of FAM with Dabcyl. When mixed with the RCA products, the loop of molecular beacon binds with the complementary sequence in RCA products, resulting in the dissociation of the stem hybrid and the restoration of the fluorescence.
The sequence of the designed molecular beacon was 5′FAM-CGCCTCTATGAGTATCTCCTATCAGAGGCG-3′Dabcyl. The simulated secondary structure by Mfold is shown in Fig.3, and the free energy was calculated to be -2.77 kcal/mol. The “on-off” performance of molecular beacon was investigated using gradient concentrations of the complementary sequence (5′-GTAGTGATAGGAGATACTCATACTGC-3′) as the targets.

Fig.3 Simulated secondary structure of molecular beacon
60 nM of molecular beacon probe was interacted with a series of concentrations of complementary sequence (0, 10, 50, 75, 100, 150, 200, and 500 pM) at the room temperature in the dark. 30 min later, the fluorescence intensity was detected (λex=492 nm,λem=520 nm). Calibration curve of fluorescence intensity vs different concentration of complementary sequence was plotted (Fig.4). The linear regression ofy=2.471x-50.778 (R2=0.954 7) was obtained, which indicated the molecular beacon can be chosen as the fluorescent probe for RCA products detection in the following studies.

Fig.4 Calibration curve for detecting of complementary sequence based on molecular beacon
2.5 Analytical performance of aptamer-based assay coupled with RCA and molecular beacon

Fig.5 Calibration curve for aptamer-based assay coupled with RCA and molecular beacon for cTnI detection
Under the optimized conditions, the aptamer-based assay coupled with RCA and molecular beacon system was successfully developed for sensitive detection of cTnI. A good linear relationship ofy=5.524 6x+83.032 (R2=0.980 6) between fluorescence intensity and cTnI concentration was obtained (Fig.5). The developed assay demonstrated the analytical performance for cTnI detection with a linear range of 50-500 pg/mL. The LOD was calculated to be 7.24 pg/mL according to the 3σrule, and the limit of quantification (LOQ) was calculated to be 59.19 pg/mL according to the 10σrule.The obtained sensitivity of our assay is higher or comparable to the reported aptamer-based biosensor for cTnI detection. For example, Dorraj et al.[3]developed a simple and rapid colorimetric detection assay for cTnI using aptamer-AuNPs conjugates based on dot blot assay, and the detection limit was found to be 5 ng/mL. Jo et al.[4]designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles for cTnI with a detection limit of 24 pg/mL. Jo et al.[21]developed a sandwich aptamer-based screen-printed carbon electrode using chronoamperometry for cTnI detection. And the detection limit was 1.0 pM (24 pg/mL).
2.6 Anti-interference capacity of aptamer-based RCA assay coupled with molecular beacon
Four kinds of interfering substances, myoglobin, human serum albumin (HSA), EDTA, and glucose, were separately added into a constant concentration of cTnI (250 pg/mL). Actual cTnI concentration was detected using the newly developed assay, and the interference ratio was calculated according to the detecting value and the added concentration of cTnI (Tab.1). It can be found that the existence of myoglobin, HSA, EDTA, and glucose did not significantly affect cTnI detection, indicating excellent selectivity and anti-interference capacity of the developed assay.

Tab.1 Interference effects of four interfering substances for cTnI detection at the constant concentration of 250 pg/mL
2.7 Quantitative detection of cTnI in human blood sample
Different concentrations of cTnI (75, 100, 150, and 250 pg/mL) were spiked in human plasma sample to further evaluate the accuracy of the proposed assay for real samples analysis. The detecting results shown in Tab.2 indicated that the recovery of cTnI was in the range of 99% to 101% with the RSDs below 3.0%, which further demonstrated that the proposed method herein can be used for sensitive detection of cTnI in complex sample matrix.

Tab.2 Recovery of cTnI in human plasma samples
3 Conclusion
Aptamer-based assay coupled with RCA and molecular beacon fluorescent probe was developed for sensitive detection of cTnI. In this strategy, aptamer can specifically recognize the target protein cTnI and act as a bridge to communicate between oligonucleotides and proteins. The RCA amplification products were detected by fluorescence molecular beacon probe. With this strategy, highly sensitive and specific detection of cTnI was realized with the LOD of 7.24 pg/mL. The assay possessed excellent selectivity and specificity, and was not interfered by other substances and plasma samples. The developed aptamer-RCA assay coupled with molecular beacon can be a promising tool in clinical samples analysis, moreover, this assay can be analyze other disease biomarkers by replacing the aptamer.
杂志排行
Journal of Beijing Institute of Technology的其它文章
- Chinese Named Entity Recognition with Character-Level BLSTM and Soft Attention Model
- Pilot Contamination Elimination in Massive MIMO Systems with an Improved Time-Shifted Scheme
- Head Motion Detection in Gaze Based Aiming
- Generating Periodic Orbits for Explorations of Elongated Asteroids
- Anti-Dead-Zone Integral Sliding Control and Active Vibration Suppression of a Free-floating Space Robot with Elastic Base and Flexible Links
- Multi-Residual Module Stacked Hourglass Networks for Human Pose Estimation
