APP下载

Improvement of Rice Blast Resistance of High-Quality Rice Variety Xiangwanxian 13 by Molecular Marker-Assisted Selection

2018-12-13LIUWenqiangLIXiaoxiangLIYongchaoPANXiaowuSHENGXinnianDUANYonghong

Agricultural Science & Technology 2018年3期

LIU Wen-qiang, LI Xiao-xiang, LI Yong-chao, PAN Xiao-wu, SHENG Xin-nian, DUAN Yonghong

Rice Research Institute, Hunan Academy of Agricultural Sciences, Changsha 410125, PRC

Abstract At present, most of high-quality rice varieties are susceptible to blast diseases. In this study, Gumei 2, a rice variety carrying broad-spectrum resistant Pi25 gene, was used as the donor, with Xiangwanxian 13 taken as the receptor and recurrent parent which is also of good quality but highly susceptible to rice blast, to improve the rice blast resistance of Xiangwanxian 13 by crossing and backcrossing based on molecular marker-assisted selection. The results showed that the resistance of the improved strains (i.e. Xiang C72, Xiang C76 and Xiang C77) to blast diseases had been enhanced significantly through field resistance identification, equaling the resistance level of Gumei 2, and the main agronomic and quality-related traits of these improved strains had been restored to the level of Xiangwanxian 13, except the chalkiness and cooking-related traits, which suggested similar genomic loci of Xiang C72, Xiang C76 and Xiang C77 to those of Xiangwanxian 13. These three improved strains (i.e. Xiang C72, Xiang C76 and Xiang C77) can provide good intermediate materials for breeding elite varieties with high grain yields and superior blast resistance.

Key words High-quality rice; Marker-assisted selection; Blast resistance

1. Introduction

As a main cereal grain in China, rice is the most widely consumed staple food for the Chinese people. Rice having undergone the “Green Revolution” has shown significant improvement in yields, making valuable contribution to the food safety of China. The total rice production in China can now satisfy the needs of all the Chinese[1],owing to the successive cultivation of super hybrid rice varieties[2]and the wide application of high-yielding cultivation techniques. Consumers have raised their requirements on rice quality with the rapid and steady improvement in economy and living standard. The cultivation of high-yield and high-quality rice varieties has become increasingly important. In comparison to hybrid rice varieties, most of the high-quality rice varieties are conventional cultivars with relatively low yields[3]. But the latter produces glittering, translucent and fragrant rice grains with low chalkiness and good taste,winning widespread popularity among consumers.

Currently, the high-quality indica rice varieties mainly include Huanghuazhan, Xiangwanxian 13, Xiangwanxian 17, the high-end quality rice Yuzhenxiang,etc. However, these high-quality varieties are susceptible to rice blast and therefore should be planted in areas with no or only low incidences of blast diseases[4-6], which has imposed serious limitations on their popularization. Besides,both the grain yield and quality would decline sharply when blast disease rages through the paddy fields.There are still no effective agro-chemicals against rice blast in the market. Chemical agents would pollute our environment and lead to excessive chemical residues in crops. An increasing number of blast-resistant genes have been accurately located or cloned with the rapid development of molecular biology[7]. Molecular marker-assisted selection is widely accepted as an economic and effective method for breeding blastresistant rice varieties.

Molecular marker-assisted crossing and backcrossing have been widely applied by researchers to improve the blast resistance of hybrid rice parents or conventional rice varieties. For example, TIAN D Get al.[8]and ZHU Y Jet al.[9]imported the broadspectrum blast-resistant genePi1andPi25into rice three-line restorer lines to obtain new restorer lines,respectively. The broad-spectrum blast-resistant genesPi1,Pi2andPi33were aggregated by DIVYA Bet al.(2014)[10]and imported into the main blast-susceptible indica cultivar ADT43. The four progeny lines and the recurrent parent ADT43 were extremely similar in forms, yields and rice quality, indicating a genetic background of over 95%. SREEWONGCHAI Tet al.[11]selected the broad-spectrum blast-resistant variety IR64 and Jao Hom Nin as donors, and crossbred them with quality indica rice varieties, thus producing a series of high-quality and blast-resistant breeding intermediates based on the self-crossed progeny by aggregating the broad-spectrum blastresistant gene with molecular markers. Pusa RH10 is a high-quality hybrid rice variety planted extensively in India. GOUDA P Ket al.[12]tried to use blast-resistant genesPi1andPiz5to modify the parent of Pusa RH10—PRR78 based on linkage markers. According to the results, there were no significant differences between the modified PRR78 and the recurrent parent PRR78 in both their forms and yields. But the combined hybrid F1showed better rice blast resistance than Pusa RH10.Researchers also used blast-resistant genes to improve high-quality fragrant rice varieties. For example, the broad-spectrum blast-resistant genePi9was applied by LUO Y C and YIN Z C[13]based on markerassisted selection to modify Thai fragrant rice Khao-Dawk Mali 105 (KDML l05). The modified strain T5105 presented high resistance to the five tested physiological races of rice blast. To date, there have been very few reports on the improvement of rice blast resistance in China’s main high-quality rice cultivars.

Rice blast-resistant gene resisting only a specific physiological race tends to lose its resistance within several years due to the complexity of rice blast fungus’ physiological races. Usually researchers would choose a broad-spectrum blast-resistant gene or aggregate the several genes into the target variety during molecular marker-assisted selection in order to enhance the durability and broad spectrum of blast resistance in new bred cultivars. Gumei 2 is a semi-dwarf blast-resistant resource which shows strong and longlasting resistance to leaf and neck blast[14-15]. Genetic researches demonstrated that this resistance is controlled byPi25, a dominant gene of the 6thchromosome[16].Further positioning and cloning revealed that the genePi25is the allele ofPid3[17-18]. In this study, Gumei 2 was chosen as a resistant donor to first cross and then successively backcross it (the hybrid progeny) with high-quality late indica Xiangwanxian 13, trying to improve the latter’s rice blast resistance throughPid3sequencing-based CAPS molecular marker selection.The new bred strains can provide intermediate materials for the breeding of high-yielding, highquality and highly-resistant cultivars.

2. Materials and Methods

2.1. Rice materials

Gumei 2 is an elite semi-dwarf rice resource with broad-spectrumPi25gene and has strong resistance to seedling and panicle neck blast disease.Xiangwanxian 13 is a conventional high-quality rice variety widely grown across Hunan Province but quite susceptible to blast diseases. In this study, Gumei 2 was selected as the donor of blast-resistant genePi25and Xiangwanxian 13 as the receptor for recurrent parent crossing. Then, backcrossing was carried out for three successive repetitions, followed by a selfcrossed generation. Individual plants resembling the performance of Xiangwanxian 13 were chosen from the BC3F2generation with the assistance of molecular markers. Fig. 1 showed the marker-assisted procedures for improving the resistance of Xiangwanxian 13 to rice blast. The positive individual plants were harvested for seeds, which were then grown in the experimental paddies of the Rice Research Institute(Changsha) and Taojiang Rice Blast Evaluation Center(Yiyang) in the following year to assess their blast resistance and yield-related performance.

Fig. 1 Marker-assisted procedures for improving resistance of Xiangwanxian 13 to rice blast

2.2. Onset of rice blast in the fields

The blast resistance experiments were conducted in Gaoqiao Rice Blast Evaluation Center (Yiyang,Hunan) for two successive years. In 2015 and 2016,the progeny strains of Gumei 2 and Xiangwanxian 13 were planted in Meishuidong Rice Blast Evaluation Center (Gaoqiao, Yiyang) for natural infection experiments. We sowed the seeds in May with a planting space of 16.5 cm×l9.8 cm; each strain consisted of 16 plants with two replications. Leaf blast and panicle neck blast were investigated during the seedling stage as well as the maturity stage. The resistance to rice blast disease was classified into 9 grades. Gumei 2 and Lijiangxintuanheigu were used as resistance and infection control.

2.3. Gene linkage marker

Based on the difference between the coding sequences of genePi25/pi25, WANGet al.[19]designed two sets of CAPS primers: CAP1 and CAP3, CAP1F: TGAAATGGGTGAAAGATGAG,CAP1R: GCCACATCATAATTCCTTGA, CAP3F:CCTCACGTTTCTACGTCTTG, CAP3R:CACACCATTTCTGATGAACC; the length of their amplified fragments were 409 bp and 406 bp,respectively. Four sets of CAPS markers (i.e. CAP1/HincⅡ , CAP3/BglⅡ , CAP3/NdeI, and CAP3/Hpy99 I) were developed according to different premier and restriction enzyme combinations, which were used to assist the polymorphic selection of Gumei 2 and Xiangwanxian 13.

2.4. DNA extraction and molecular marker detection

In this research, the methods of DNA extraction and PCR amplification were presented by LU Y Jet al.[20]and CHEN Xet al.[21], respectively. The restriction endonuclease enzyme (NdeI) for the digestion experiment of PCR amplification products was purchased from TaKaRa Company. The experiment was carried out according to the manufacturer’s instruction. Electrophoresis for enzyme-digested products was conducted using 2%agarose gel.

2.5. Yield-related traits

In 2015 and 2016, both the target strains and Xiangwanxian 13 were planted in the experimental paddies of the Rice Research Institute (Changsha).The seeds were sowed on May 20thand transplanted on June 10thwith a planting space of 19.8 cm×19.8 cm. Each strain contained three replications and each replication included 80 plants. The plant height and field performance during the heading stage were observed. Nine individual plants were harvested from each replication when they reached maturity; the PL,NPP, NFGP, SS, TGW and YP were measured and then analyzed using DPSv14.1 software[22].

2.6. Grain quality-related traits

The seeds were dried in the sun and stored at room temperature for three months before measuring their grain quality-related traits, such as BRR, MRR,HRR, CGR, CD, GL, LWR, AC, GC, ASV and PC. The data were also analyzed with DPSv14.1 software[22].

3. Results and Analysis

3.1. Positive individual plants

Four sets of CAPS markers was used to polymorphically screen Gumei 2 and Xiangwanxian 13,which showed that CAP3/NdeI displayed distinct polymorphic bands among the parents, CAP3/Hpy99I and CAP3/BglII presented no polymorph, and the bands of CAP1/HincII were not clear. Therefore,CAP3/NdeI was selected to test the genes of the hybrid progeny. Finally, three individual plants (Fig. 2)presenting homozygousPi25and good agronomic traits were obtained in BC3F2generation, and then named as Xiang C72, Xiang C76 and Xiang C77.

3.2. Performance of resistance to rice blast

The field performances of Xiang C72, C76 and C77’s resistance to blast disease were listed in Table 1. Generally, Xiang C72, C76 and C77 showed consistency in field performance in the two years. The seedling (or leaf) blast scoring was Level 2 or 3; the panicle neck blast scoring was Level 3. Both presented the mid-resistance. The parent Gumei 2 showed steady resistance during the two years. Specifically, its scoring of seedling (or leaf) blast was Level 2, and its scoring of panicle neck blast was Level 3, which also presented the mid-resistance. Xiangwanxian 13 and the control Lijiangxintuanheigu were infected with both seedling (or leaf) blast and panicle neck blast,which proved the authenticity and reliability of the above results. The findings revealed that the improved strains (i.e. Xiang C72, C76 and C77) have reached the same blast-resistant level as Gumei 2.

3.3. Main agronomic and agronomic-related traits

Fig. 2 Detection of Pi25 gene in BC3F2 lines

Table 1 Field performance of improved lines to blast isolates

The yield and yield-related traits of Xiang C72,C76 and C77 were listed in Table 2. In 2014, the plant height of Xiang C72 was 5.3 cm shorter than Xiangwanxian 13 (P<0.05), presenting significant difference. But there were no significant differences in other traits. All the traits of Xiang C76 were similar to those of Xiangwanxian 13. For Xiang C77, its heading period was four days shorter than Xiangwanxian 13 (P<0.01), indicating significant difference; its plant height was 9.8 cm shorter than Xiangwanxian 13 (P<0.01), which reached top significant level;the number of its panicles was 1.9 higher than Xiangwanxian 13 (P<0.05), which also presented significant difference. No significant difference was observed between the other traits of Xiang C77 and Xiangwanxian 13.

In 2015, Xiang C72 was 8.1 cm shorter than Xiangwanxian 13 (P<0.05), and its seed setting rate was 8.2% lower than Xiangwanxian 13’s (P<0.05),presenting significant difference. No significant difference was observed between other traits. The plant of Xiang C76 was 6.1 cm shorter than that of Xiangwanxian 13 (P<0.05); the average number of grains on each panicle for Xiang C76 was 18.6 smaller than that of Xiangwanxian 13 (P<0.05); its seed setting rate was 6.6% lower than Xiangwanxian 13’s(P<0.05), which all indicated significant differences.The plant of Xiang C76 was 6.1 cm shorter than that of Xiangwanxian 13 (P<0.05); the length of its panicle was 3.9 cm shorter than Xiangwanxian 13’s (P<0.01),presenting extreme significant difference. But there were no significant differences in other traits. For Xiang C77, its TGW and YP were similar to those of Xiangwanxian 13. Significant or extremely significant differences could be found in other traits. For example, Xiang C77’s heading period was 6 d shorter(P<0.01) and its plant was 4.7 cm shorter (P<0.01)than Xiangwanxian 13’s, both revealing extreme significant differences. Its panicle was 1.1 cm (P<0.05)longer than that of Xiangwanxian 13 and each plant included 1 more panicle (P<0.05); the NFGP of Xiang C77 was 35.1 grains less than that of Xiangwanxian 13 and therefore its seed setting rate was 8.2% lower(P<0.05), which all presented significant difference.

Table 2 Performance of yield and yield-related traits of improved lines in field

Generally, the trait performance varies with the materials in the two years. The data collected in the two years showed that Xiangwanxian 13 was significantly taller than Xiang C72; the heading period and plant height of Xiangwanxian 13 were extremely larger than those of Xiang C77, while the number of its panicles was significantly smaller than that of the Xiang C77. These results are a further proof of the gap. According to the field tests, differences only exist in a few traits between Xiangwanxian 13 and the improve strains (i.e. Xiang C72, C76 and C77). Most traits of the latter have restored to the level of the former.

3.4. Performance in grain quality

The grain quality and related traits of Xiang C72, Xiang C76 and Xiang C77 were listed in Table 3.Compared with Xiangwanxian 13, the CGR, CD and GC of Xiang C72 were high by 13.5% (P<0.01), 1.7%(P<0.01) and 22 mm (P<0.01), indicating extreme significant difference. As for AC and ASV, Xiang C72 was 2.6% (P<0.01) and 3 grades (P<0.01) lower than Xiangwanxian 13, respectively, also presenting significant differences. But there were no significant differences in other traits. Xiang C76 in terms of CGR,CD, AC and GC was 33.0% (P<0.01), 5.0% (P<0.01),3.8% (P<0.01) and 23.5 mm (P<0.01) higher than Xiangwanxian 13, all of which indicated extreme significant differences. The ASV of Xiang C76 was 3 grades lower than Xiangwanxian 13 (P<0.01),also indicating extreme significant difference. There were no further differences between other traits. For Xiang C77, its CGR, CD and AC were 18% (P<0.01),1.2% (P<0.01) and 2.8% (P<0.01) higher than Xiangwanxian 13’s, presenting extreme significant differences. But its GC and ASV were 20.5 mm(P<0.01) and 3 grades (P<0.01) lower than the latter’s,which also indicated extreme significant difference.There were no further differences between other traits as well.

Table 3 Performance of grain quality of improved strains

To conclude, the improved strains were higher in the CGR, CD, AC, GC and chalkiness size, but with lower ASV. Other grain quality-related traits were similar to those of Xiangwanxian 13.

4. Discussion

Molecular marker-assisted selection (MAS)can not only effectively reduce labour and financial costs, but also accelerate the breeding process and thus shorten the breeding period because of its goaloriented and highly-efficient character. Therefore,the MAS is very popular in disease-resistant and insect-resistant rice breeding[23-24]. In this research, we chose the broad-spectrum blast-resistant genePi25as the donor and imported it into the high-quality late indica Xiangwanxian 13 through the MAS. The field performance of the improved strains to blast isolates was observed and analyzed. The results showed that the resistance of the improved strains (i.e. Xiang C72, Xiang C76 and Xiang C77) to blast disease had been enhanced significantly throughout these two years, equaling the resistance level of Gumei 2.Consequently, it is feasible to improve Xiangwanxian 13’s blast resistance by usingPi25gene and the MAS.

When applying the MAS to improve the resistance of a target variety, the more the backcrossing procedure we repeat, the more likely the genetic background of the progeny is to resemble the receptor.In this study, Xiang C72, Xiang C76 and Xiang C77 were selected from the BC3F2generation of Gumei 2 and Xiangwanxian 13. Then, we tested the yield and yield-related traits of their self-crossed progeny. For the above three improved strains, most of their traits closely resembled Xiangwanxian 13’s, indicating similar genetic background. However, some traits were observed to be quite different from Xiangwanxian 13’s in the two years, such as the heading period and plant height, which might be caused by the difference in their genetic background. Some differences were only observed in one year, which could be related to environmental factors. We also noticed that a certain trait of the same material might also vary widely in different years. For example, the heading periods in 2015 were longer than in 2014, so were the plant heights. A possible explanation was that these differences were caused by external factors, such as the soil fertility of different rice paddies, despite the fact that the experiments were carried out in the same site. It is noteworthy that there were no significant differences between Xiangwanxian 13 and the three improved strains concerning their grain-yield-per-plant in the two years, indicating that the grain yields of Xiang C72, Xiang C76 and Xiang C77 approximated to that of Xiangwanxian 13.

The popularization of two-line hybrid rice has solved the problem of poor grain quality of the threeline hybrid rice while maintaining high yield. But their grain quality is still inferior to that of conventional high-quality rice varieties. In addition to grain yield, a growing number of people have been calling for better grain quality in recent years. The experts therefore are trying hard to improve the grain quality of various rice lines. In this research, we tested the grain quality of Xiang C72, Xiang C76 and Xiang C77. The results showed that they have reached the required standard of high-quality rice regarding their milling traits. But they were far from standard high-quality rice in terms of chalkiness-related traits. Additionally, there’s still much room for improvement in cooking-related traits,which can be realized by backcrossing them with Xiangwanxian 13.

In this research, thePi25gene of Gumei 2 was imported into Xiangwanxian 13 to improve the latter’s resistance to rice blast. Totally, three new strains were obtained, namely, Xiang C72, Xiang C76 and Xiang C77. They all presented enhanced blast resistance and good grain yield, which can substitute for Xiangwanxian 13 when it comes to rice blast resistance. But the chalkiness and cookingrelated traits of the improved strains can be further enhanced by backcrossing them with Xiangwanxian 13. These materials can provide useful intermediates for breeding elite varieties with high grain yields and good blast resistance.


登录APP查看全文